Review



control scrambled sequence  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc control scrambled sequence
    Control Scrambled Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 175 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control scrambled sequence/product/Addgene inc
    Average 93 stars, based on 175 article reviews
    control scrambled sequence - by Bioz Stars, 2026-03
    93/100 stars

    Images



    Similar Products

    90
    Santa Cruz Biotechnology scrambled sequence control sirna-a
    Scrambled Sequence Control Sirna A, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scrambled sequence control sirna-a/product/Santa Cruz Biotechnology
    Average 90 stars, based on 1 article reviews
    scrambled sequence control sirna-a - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Ribobio co control sirna containing a scrambled sequence si-nc
    Control Sirna Containing A Scrambled Sequence Si Nc, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control sirna containing a scrambled sequence si-nc/product/Ribobio co
    Average 90 stars, based on 1 article reviews
    control sirna containing a scrambled sequence si-nc - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma adenoviral vectors expressing a control scrambled sequence
    Adenoviral Vectors Expressing A Control Scrambled Sequence, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/adenoviral vectors expressing a control scrambled sequence/product/Shanghai GenePharma
    Average 90 stars, based on 1 article reviews
    adenoviral vectors expressing a control scrambled sequence - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    93
    Addgene inc control scrambled sequence
    Control Scrambled Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control scrambled sequence/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    control scrambled sequence - by Bioz Stars, 2026-03
    93/100 stars
      Buy from Supplier

    93
    Addgene inc control scrambled sequence gcgcgctttgtaggattcgtt
    Control Scrambled Sequence Gcgcgctttgtaggattcgtt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control scrambled sequence gcgcgctttgtaggattcgtt/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    control scrambled sequence gcgcgctttgtaggattcgtt - by Bioz Stars, 2026-03
    93/100 stars
      Buy from Supplier

    90
    Sangon Biotech negative control sirna with scramble sequence
    Negative Control Sirna With Scramble Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control sirna with scramble sequence/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    negative control sirna with scramble sequence - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Sangon Biotech scrambled sequence as negative control
    Scrambled Sequence As Negative Control, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scrambled sequence as negative control/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    scrambled sequence as negative control - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma control sirna with scrambled sequence
    Control Sirna With Scrambled Sequence, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control sirna with scrambled sequence/product/Shanghai GenePharma
    Average 90 stars, based on 1 article reviews
    control sirna with scrambled sequence - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher scrambled negative control sirna sequence
    <t>TTN-AS1-276</t> regulates inclusion of I-band exons in TTN . ( A ) Per cent spliced in (PSI) for all exons across the TTN gene calculated based on RNA-sequencing reads from human iPS-derived cardiomyocytes (IPS-CM). The line represents the mean of three replicates (individual RNA preparations) per experimental group. ( B ) The difference in PSI (ΔPSI) comparing cells transfected with <t>siRNA</t> to TTN-AS1-276 (si276-Ex1) with cells transfected with scrambled negative control siRNA (siScr). Exons with statistically significant ΔPSI are marked with red bars (adjusted P < 0.05). ( C ) Depiction of exon skipping from TTN exon 49. ( D ) Quantification of TTN splice products in iPS-CM transfected with si276-Ex1, si276-Ex12, siRBM20 or siScr, using custom qRT–PCR assays spanning the indicated exon–exon junctions. Expression data are normalized to that of total TTN and expressed relative to the mean of the negative control cells (siScr). Data are derived from two separate experiments with 3–6 replicates (individual RNA preparations) per experimental group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001.
    Scrambled Negative Control Sirna Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scrambled negative control sirna sequence/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    scrambled negative control sirna sequence - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Santa Cruz Biotechnology control plasmid encoding a scrambled shrna sequence
    <t>TTN-AS1-276</t> regulates inclusion of I-band exons in TTN . ( A ) Per cent spliced in (PSI) for all exons across the TTN gene calculated based on RNA-sequencing reads from human iPS-derived cardiomyocytes (IPS-CM). The line represents the mean of three replicates (individual RNA preparations) per experimental group. ( B ) The difference in PSI (ΔPSI) comparing cells transfected with <t>siRNA</t> to TTN-AS1-276 (si276-Ex1) with cells transfected with scrambled negative control siRNA (siScr). Exons with statistically significant ΔPSI are marked with red bars (adjusted P < 0.05). ( C ) Depiction of exon skipping from TTN exon 49. ( D ) Quantification of TTN splice products in iPS-CM transfected with si276-Ex1, si276-Ex12, siRBM20 or siScr, using custom qRT–PCR assays spanning the indicated exon–exon junctions. Expression data are normalized to that of total TTN and expressed relative to the mean of the negative control cells (siScr). Data are derived from two separate experiments with 3–6 replicates (individual RNA preparations) per experimental group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001.
    Control Plasmid Encoding A Scrambled Shrna Sequence, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control plasmid encoding a scrambled shrna sequence/product/Santa Cruz Biotechnology
    Average 90 stars, based on 1 article reviews
    control plasmid encoding a scrambled shrna sequence - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    Image Search Results


    TTN-AS1-276 regulates inclusion of I-band exons in TTN . ( A ) Per cent spliced in (PSI) for all exons across the TTN gene calculated based on RNA-sequencing reads from human iPS-derived cardiomyocytes (IPS-CM). The line represents the mean of three replicates (individual RNA preparations) per experimental group. ( B ) The difference in PSI (ΔPSI) comparing cells transfected with siRNA to TTN-AS1-276 (si276-Ex1) with cells transfected with scrambled negative control siRNA (siScr). Exons with statistically significant ΔPSI are marked with red bars (adjusted P < 0.05). ( C ) Depiction of exon skipping from TTN exon 49. ( D ) Quantification of TTN splice products in iPS-CM transfected with si276-Ex1, si276-Ex12, siRBM20 or siScr, using custom qRT–PCR assays spanning the indicated exon–exon junctions. Expression data are normalized to that of total TTN and expressed relative to the mean of the negative control cells (siScr). Data are derived from two separate experiments with 3–6 replicates (individual RNA preparations) per experimental group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001.

    Journal: Cardiovascular Research

    Article Title: Antisense-mediated regulation of exon usage in the elastic spring region of Titin modulates sarcomere function

    doi: 10.1093/cvr/cvaf037

    Figure Lengend Snippet: TTN-AS1-276 regulates inclusion of I-band exons in TTN . ( A ) Per cent spliced in (PSI) for all exons across the TTN gene calculated based on RNA-sequencing reads from human iPS-derived cardiomyocytes (IPS-CM). The line represents the mean of three replicates (individual RNA preparations) per experimental group. ( B ) The difference in PSI (ΔPSI) comparing cells transfected with siRNA to TTN-AS1-276 (si276-Ex1) with cells transfected with scrambled negative control siRNA (siScr). Exons with statistically significant ΔPSI are marked with red bars (adjusted P < 0.05). ( C ) Depiction of exon skipping from TTN exon 49. ( D ) Quantification of TTN splice products in iPS-CM transfected with si276-Ex1, si276-Ex12, siRBM20 or siScr, using custom qRT–PCR assays spanning the indicated exon–exon junctions. Expression data are normalized to that of total TTN and expressed relative to the mean of the negative control cells (siScr). Data are derived from two separate experiments with 3–6 replicates (individual RNA preparations) per experimental group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001.

    Article Snippet: For knockdown experiments, cells were transfected with Silencer Select siRNA (ThermoFisher) directed towards exon 1 (si276-Ex1, #n294437) or exon 12 (si276-Ex12, custom design ID #ABRSBMG) of TTN-AS1-276, towards RBM20 (ENST00000369519.4, #s49081) or with a scrambled negative control siRNA sequence (#4390843).

    Techniques: RNA Sequencing, Derivative Assay, Transfection, Negative Control, Quantitative RT-PCR, Expressing, Control

    TTN-AS1-276 facilitates interaction between RBM20 and TTN mRNA. ( A – C ) Human iPS-derived cardiomyocytes (iPS-CM) were subjected to combined RNA in situ hybridization (ISH) for TTN-AS1-276 (magenta) and TTN (orange) and immunofluorescence for RBM20 (green) following transfection with siRNA towards TTN-AS1-276 (si276-Ex1), RBM20 (siRBM20), or scrambled negative control siRNA (siScr). Nuclei were counterstained with DAPI. Co-localization of TTN and RBM20 foci was analysed with high content imaging. ( D ) Depiction of experimental design for the RBM20 RNA immunoprecipitation (RIP) experiment. iPS-CM was transfected with a plasmid expressing a RBM20-GFP fusion protein. RIP was performed on iPS-CM protein using a GFP antibody and qRT–PCR was used to analyse immunoprecipitated RNA. ( E ) Enrichment of TTN and TTN-AS1-276 in GFP-RBM20 RIP RNA from iPS-CM transfected with si276-Ex1 or siScr, analysed with qRT–PCR. Analysis of unrelated GAPDH RNA was included as a negative control. Data are derived from two separate experiments with two technical replicates (individual immunoprecipitates) in each group * P < 0.05, ** P < 0.01. ( F ) The number of TCTT motifs/60 bp across intron 49 of TTN . The positions of RIP-qPCR assays used in ( G ) are indicated with dashed lines. ( G ) qPCR of GFP-RBM20 RIP RNA from ( E ) using assays targeting regions in intron 49 without TCTT motifs (‘In49 5p’) and enriched with TCTT motifs (‘In49 TCTT’). Data are derived from two separate experiments with two technical replicates (individual immunoprecipitates) in each group. Differences in the RIP signal between cells transfected within and between groups were assessed using ANOVA with Dunnett’s multiple comparisons test, * P < 0.05, ** P < 0.01.

    Journal: Cardiovascular Research

    Article Title: Antisense-mediated regulation of exon usage in the elastic spring region of Titin modulates sarcomere function

    doi: 10.1093/cvr/cvaf037

    Figure Lengend Snippet: TTN-AS1-276 facilitates interaction between RBM20 and TTN mRNA. ( A – C ) Human iPS-derived cardiomyocytes (iPS-CM) were subjected to combined RNA in situ hybridization (ISH) for TTN-AS1-276 (magenta) and TTN (orange) and immunofluorescence for RBM20 (green) following transfection with siRNA towards TTN-AS1-276 (si276-Ex1), RBM20 (siRBM20), or scrambled negative control siRNA (siScr). Nuclei were counterstained with DAPI. Co-localization of TTN and RBM20 foci was analysed with high content imaging. ( D ) Depiction of experimental design for the RBM20 RNA immunoprecipitation (RIP) experiment. iPS-CM was transfected with a plasmid expressing a RBM20-GFP fusion protein. RIP was performed on iPS-CM protein using a GFP antibody and qRT–PCR was used to analyse immunoprecipitated RNA. ( E ) Enrichment of TTN and TTN-AS1-276 in GFP-RBM20 RIP RNA from iPS-CM transfected with si276-Ex1 or siScr, analysed with qRT–PCR. Analysis of unrelated GAPDH RNA was included as a negative control. Data are derived from two separate experiments with two technical replicates (individual immunoprecipitates) in each group * P < 0.05, ** P < 0.01. ( F ) The number of TCTT motifs/60 bp across intron 49 of TTN . The positions of RIP-qPCR assays used in ( G ) are indicated with dashed lines. ( G ) qPCR of GFP-RBM20 RIP RNA from ( E ) using assays targeting regions in intron 49 without TCTT motifs (‘In49 5p’) and enriched with TCTT motifs (‘In49 TCTT’). Data are derived from two separate experiments with two technical replicates (individual immunoprecipitates) in each group. Differences in the RIP signal between cells transfected within and between groups were assessed using ANOVA with Dunnett’s multiple comparisons test, * P < 0.05, ** P < 0.01.

    Article Snippet: For knockdown experiments, cells were transfected with Silencer Select siRNA (ThermoFisher) directed towards exon 1 (si276-Ex1, #n294437) or exon 12 (si276-Ex12, custom design ID #ABRSBMG) of TTN-AS1-276, towards RBM20 (ENST00000369519.4, #s49081) or with a scrambled negative control siRNA sequence (#4390843).

    Techniques: Derivative Assay, RNA In Situ Hybridization, Immunofluorescence, Transfection, Negative Control, Imaging, RNA Immunoprecipitation, Plasmid Preparation, Expressing, Quantitative RT-PCR, Immunoprecipitation

    TTN-AS1-276 facilitates splicing of additional RBM20 targets. ( A – C ) Difference in PSI (ΔPSI) comparing cells transfected with siRNA to TTN-AS1-276 (si276-Ex1, blue) or RBM20 (siRBM20, red) with cells transfected with scrambled negative control siRNA (siScr) across all exons of the ( A ) CACNA1C , ( B ) LMO7 , and ( C ) CAMK2D genes in human iPS-derived cardiomyocytes (iPS-CM). The lines represent the mean of three technical replicates (individual RNA preparations). ( D – F ) Relative expression of alternative splice products of the ( D ) CACNA1C , ( E ) LMO7 , and ( F ) CAMK2D genes in iPS-CM transfected with siRBM20, si276-Ex1 or siScr and analysed with qRT–PCR ( CACNA1C and LMO7 ) and semi-quantitative RT–PCR ( CAMK2D ), respectively. Data are derived from three separate experiments with three technical replicates (individual RNA preparations) in each group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001. ( G ) Enrichment of CACNA1C , LMO7 , and CAMK2D in GFP-RBM20 RIP RNA from iPS-CM transfected with si276-Ex1 or siScr, analysed with qRT–PCR. Analysis of unrelated GAPDH RNA was included as a negative control. Data are derived from two separate experiments.

    Journal: Cardiovascular Research

    Article Title: Antisense-mediated regulation of exon usage in the elastic spring region of Titin modulates sarcomere function

    doi: 10.1093/cvr/cvaf037

    Figure Lengend Snippet: TTN-AS1-276 facilitates splicing of additional RBM20 targets. ( A – C ) Difference in PSI (ΔPSI) comparing cells transfected with siRNA to TTN-AS1-276 (si276-Ex1, blue) or RBM20 (siRBM20, red) with cells transfected with scrambled negative control siRNA (siScr) across all exons of the ( A ) CACNA1C , ( B ) LMO7 , and ( C ) CAMK2D genes in human iPS-derived cardiomyocytes (iPS-CM). The lines represent the mean of three technical replicates (individual RNA preparations). ( D – F ) Relative expression of alternative splice products of the ( D ) CACNA1C , ( E ) LMO7 , and ( F ) CAMK2D genes in iPS-CM transfected with siRBM20, si276-Ex1 or siScr and analysed with qRT–PCR ( CACNA1C and LMO7 ) and semi-quantitative RT–PCR ( CAMK2D ), respectively. Data are derived from three separate experiments with three technical replicates (individual RNA preparations) in each group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001. ( G ) Enrichment of CACNA1C , LMO7 , and CAMK2D in GFP-RBM20 RIP RNA from iPS-CM transfected with si276-Ex1 or siScr, analysed with qRT–PCR. Analysis of unrelated GAPDH RNA was included as a negative control. Data are derived from two separate experiments.

    Article Snippet: For knockdown experiments, cells were transfected with Silencer Select siRNA (ThermoFisher) directed towards exon 1 (si276-Ex1, #n294437) or exon 12 (si276-Ex12, custom design ID #ABRSBMG) of TTN-AS1-276, towards RBM20 (ENST00000369519.4, #s49081) or with a scrambled negative control siRNA sequence (#4390843).

    Techniques: Transfection, Negative Control, Derivative Assay, Expressing, Quantitative RT-PCR, Control